Login
Login
Register
Complete Your Profile
Change Password
Request a Password Reset
Download Documents
Download Documents
Get Help to Participate in This Tender
STATE INSTITUTION "INSTITUTE OF PROBLEMS OF ENDOCRINE PATHOLOGY has floated a tender for Dk: 021: 2015 - 33690000-3 Medicines are Different (Medical Products Except Medicines). The project location is Ukraine and the tender is closing on 23 Jul 2025. The tender notice number is UA-2025-07-15-010690-a, while the TOT Ref Number is 122738289. Bidders can have further information about the Tender and can request the complete Tender document by Registering on the site.
Procurement Summary
Country : Ukraine
Summary : Dk: 021: 2015 - 33690000-3 Medicines are Different (Medical Products Except Medicines)
Deadline : 23 Jul 2025
Other Information
Notice Type : Tender
TOT Ref.No.: 122738289
Document Ref. No. : UA-2025-07-15-010690-a
Financier : Self Financed
Purchaser Ownership : Public
Tender Value : UAH 753200
Purchaser's Detail
Name :Login to see tender_details
Address : Login to see tender_details
Email : Login to see tender_details
Login to see detailsTender Details
Type of purchase: goods
DK 021: 2015: 33600000-6: Pharmaceutical products
DNA Polymerase DNA Polymerase, Recombinant (5 U/μL)), 10x500 Units (EP0406), DNA Polymerase DNA Polymerase, Recombinant (5 U/μL)) (EP0402), DNA Polymerase Dreamtaq ™ Hot Start Dna Polymerase, 500 units (EP1702), water, water, water free from nuclease, 100 ml (R 0582), marker DNA gel loading dye (6x), 5x1ml (R0611), marker PUC19 DNA/MSPI (HPAII), 50 μg (SM0221), Agarozh (R) Gram (SM0221) Genomic DNA PURRIFICATION KIT, 100 reactions (K0512), reagent for PCR Dntp Mix (2 MM Each), 1 ml (R0241), Reagent for PCR DNTP MIx (10 MM Each), 1 ml (R0192), Generumer Marker 1 KB DNA LADDER, READY-TO-US, 5x50 NG (SM0313), Etyium Bromide ULTRAPURIPURE ™ Ethid ™ Etidium Ethid ™ Etidium. (15585011), TBE Buffer electrophoresis buffer Methyledge Bisulfite Conversion System, 50 reactions (N1301), methylated control human DNA, 5 mcg control DNA to the previous set (N1231), DNA oligonucleotide synthesis, 25 NMol, Desolted (10629186) F5'GCTGGGGTCCTTGCGCGCGCCATAGT3 '(to detect methylation), DNA synthesis of oligonucleotide, 25 nmol, desolted (10629186) LEP 51NN R5'CGGCCCGATCACAACTTGCGCG3 '(for the detection of methylation), DNA synthesis of oligonucleotides, 25 nmol, desolted (10629186) LEP 31NNTTTCCTCCTCTCTCTCCTCTCCTCCTCCTCCTCCTCCTCCTCCCTCCTCCTCCTCCCTCCTCCCCTCCCCTCCCCTCCCCT. Oligonucleotide DNA Synthesis, 25 NMol, Desolted (10629186) LEP 31NNT R5'CCTGCCCCGC ...
Documents
Procurement Documents for Ukraine
Access a comprehensive library of standard procurement documents specific to Ukraine. Here, you'll find all the essential forms, guidelines, and templates required for tender applications and submissions in Ukraine
Want To Bid in This Tender?
Get Local Agent Support in Ukraine and 60 More Countries.
View Tenders By
Sign in with Google